how to print fasta file into jtable using netbeans IDE

mt file is :

contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt

contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg

now i want to print the lines "contig00001 length=586 numreads=4 "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea in netbeans IDE. when i click the any row in jtable,particular sequence should be displayed in jtextarea.please help me in this assignment. thanks.

View Answers









Related Tutorials/Questions & Answers:
how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE   mt file... in netbeans IDE. when i click the any row in jtable,particular sequence should... ctgaggactcctcg now i want to print the lines "contig00001 length=586 numreads=4
how to load flash file in any browser through jsp using NetBeans IDE without embed tag
how to load flash file in any browser through jsp using NetBeans IDE without embed tag  I am trying to load a flash file in broser from local disk using jsps.But it's not loading. I used tag like this <object id
Advertisements
how to launch a web application using java web start in netbeans ide?
how to launch a web application using java web start in netbeans ide?  Hi RoseIndia, I need to launch my web application(web pages-jsp) using java web start in Netbeans IDE, Please can anyone help me how to do this...I knw
To create an web application using netbeans IDE
To create an web application using netbeans IDE  Hi, I'm a beginner in java and I have created an jsp code for entering the username password... username and password details should enter in to oracle database.I want to know how
Java Programming using Netbeans - IDE Questions
Java Programming using Netbeans  Hello Dear sir, i got one scenario where i have to pick the data of the student like id , name , class , age & address using netbeans jframe then i have to store these data into my package so
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable   my text file... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest the logic to print such scenario thanks
How to Configure Tomcat Apache in Netbeans IDE
How to Configure Tomcat Apache in Netbeans IDE  Can any one tell me how to add tomcat server in Netbeans IDE? With its steps ?? Thnx
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0  text file... area which is design below table in netbeans IDE. how to do that ? pls help me... want to displaythe above .txt file in jtable as following format having 3
how to create a header in jtable using java swing
how to create a header in jtable using java swing  how to create a header in jtable using java swing   d
Create JSF Application Using NetBeans IDE
Create JSF Application Using NetBeans IDE  ... environment (IDE) written in the Java programming language. The NetBeans project... as an applicable framework to generate any type of application. The NetBeans 6.1 IDE
how to connection jsp to oracle database connections in netbeans ide
how to connection jsp to oracle database connections in netbeans ide  how to connect jsp to oracle database connections in netbeans ide?pls provide screenshots if possible
how to connection jsp to oracle database connections in netbeans ide
how to connection jsp to oracle database connections in netbeans ide  how to connect jsp to oracle database connections in netbeans ide?pls provide screenshots if possible
how can i use ajax and jquery in netbeans ide
how can i use ajax and jquery in netbeans ide  i am using .net here we hav to download ajax controls and if i use netbeans ide and uses ajax control so from where i can get these controls.also i want to know which struct book i
How to Develop, Compile & Run a rmi Program in NetBeans 6.9.1 ide?
How to Develop, Compile & Run a rmi Program in NetBeans 6.9.1 ide?  how to develop, compile & run a rmi program in netbeans 6.9.1 ide? will you please give me a step by step (practical) explaination? Thanks in advance
how to send the content of jtextarea from netbeans IDE to webpage's textarea in java
how to send the content of jtextarea from netbeans IDE to webpage's textarea in java   Hi, i m interested to send the content of my jtextarea which i have developed in netbeans IDE to the webpage's textarea. how can i do
how can i run ASP.Net Server from netbeans IDE?
how can i run ASP.Net Server from netbeans IDE?  please help me how can i run ASP.Net Server from netbeans IDE? in other word , I have a web services... is wrote with netbeans Pleas I want a quick response
how to print all colors using awt
how to print all colors using awt  how to print all colors using awt
NetBeans - IDE Questions
NetBeans  Can we use netbeans to create servlet, jsp pages?If yes means can you explain how it can be done? how to use netbeans for creating jsp...://www.roseindia.net/jsf/netbeans/create-jsf-application.shtml Hope that it will be helpful
netbeans resource prob - IDE Questions
netbeans resource prob  Hi,please can you tell me how to include a file like an image in the jar package in netbeans so that i dont need to provide... i the jar package I am using netbeans version 6.7.1
a complete project on spring web mvc using oracle database in netbeans ide 7.0
a complete project on spring web mvc using oracle database in netbeans ide 7.0  dear sir , i want a complete tutorial on the title matter.please sir help me . any full developped project based on shopping cart can
Which one is better for creating a GUI using swings either Manual coding or IDE(NetBeans,eclipse)..? drag and dropping components
Which one is better for creating a GUI using swings either Manual coding or IDE(NetBeans,eclipse)..? drag and dropping components  I am beginner... swings either Manual coding or IDE(NetBeans,eclipse)..? drag and dropping components
how to print HTML using javascript or Jquery
how to print HTML using javascript or Jquery  is there any way to print a document(created using Html and javascript) without using window.print... used Iframe for print, but this only work in chrome, but I have required one
How to print the following output using c program
How to print the following output using c program  1) 4 3 4 2 3 4 1 2 3 4 2) A B C D E F G H I J
netbeans - IDE Questions
netbeans  I am uploading pdf file to tomcat server and i am using net beans. I am saving my file in /web/PDF/ directory. and my prob is when i am viewing my file I can not get it back by using http://localhost:8084/PDF
SQL STATEMENT in JDBC in NETBEANS IDE
SQL STATEMENT in JDBC in NETBEANS IDE  Iam using NETBEANS IDE. Iam developing a bank application. Using JDBC in SERVLETS For the withdraw function, "bal" and "ano" are user inputs when i wrote like, st.executeQuery("UPDATE
unable to display image using html tag in servlet.(image src is in a variable.....). i am using netbeans IDE. plz..........do help
unable to display image using html tag in servlet.(image src is in a variable.....). i am using netbeans IDE. plz..........do help  import... { Hashtable ht=null; UploadFile file=null; try
How to open a .war file inside Netbean IDE? - IDE Questions
How to open a .war file inside Netbean IDE?  Dear experts, I've been trying to read a .war file inside my Netbean IDE alot of times... netbean as .war file. When I pressed the run tab inside my netbean ide to see how
NetBeans IDE
NetBeans IDE         The NetBeans IDE, product of Sun Microsystems, is a free, open-source.... NetBeans IDE supports developers providing all the tools needed to create all
Web Services Examples in NetBeans
; In this section we will develop webservices using NetBeans IDE. NetBeans IDE is one... and test the webservices very easily in the NetBeans IDE. NetBeans... the webservices example in NetBeans IDE. Web Service
netbeans coding prob - IDE Questions
() etc how should i do it? both classes are in the same package. PLEASE TELL ME HOW TO DO IT IN NETBEANS. THANK YOU  Hi Friend, Please visit...netbeans coding prob  hi, i have just started programming in netbeans
jtable
jtable  hi Sir i am working netbeans IDE,I have a jtable when i insert values in jtable then i am unable to print all inserted values... 1,2,3,4,5,6,7,null. why it is not print 8 in place of "null" plz help me regards ravi
How to launch my web application from my desktop without opening Netbeans IDE everytime i run the application?
How to launch my web application from my desktop without opening Netbeans IDE... to open Netbeans IDE then need to start Glassfish server,then type the url, so i... for my previous question but i knw how to create JSP pages, I have completed my
Java insert file data to JTable
Java insert file data to JTable In this section, you will learn how to insert text file data into JTable. Swing has provide useful and sophisticated set... with AbstractTableModel to inherit its methods and properties. Now we have read the file
Print Matchingwords using Regular expression
Print Matchingwords using Regular expression       This Example describe the way to print the matching word from the file using Regularexpression. The steps involved in 
Extract File data into JTable
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... implementations for most of the methods in the TableModel interface. Using
java login form using netbeans
java login form using netbeans  how to connect an access database to a login form using netbeans
How to add JTable in JPanel
How to add JTable in JPanel  How to add JTable in JPanel
How to zip a file using javascrip?
How to zip a file using javascrip?  hi.. can anyone tell me How to zip a file using javascrip
How to write to file using FileOutputStream
How to write to file using FileOutputStream  Hi friends, Please help me in java program. How to write to file using FileOutputStream? thanks,   Hi, To write a file using FileOutputStream, we have to use
How to write to file using FileWriter
How to write to file using FileWriter  hi, How to write to file using FileWriter thanks,   Hi, To writing in a file in Java program we... of the FileWriter class can be created using the following of its constructor i.e. FileWriter
CONVERT JTable DATA TO PDF FILE
CONVERT JTable DATA TO PDF FILE  HOW TO CONVERT JTable DATA TO .PDF FILE??PLEASE GIVE ME CODE FOR THAT.   Here is an example that reads the jtable data from the jframe and stored the data into the pdf file in the form
How to upload file using JSP?
How to upload file using JSP?   Hi all, I m the beginner in JSP, I want to upload file on server in specific folder.   1)page.jsp... file upload form to the user</TITLE></HEAD> <
Not able to filter rows of jtable with textfield in netbeans
Not able to filter rows of jtable with textfield in netbeans  ...", "Item", "Qty In Boxes"}; tblStock = new JTable(data,header); sorter=new... of implementing row filter to the 4th column of jtable with a textfield but its
Not able to filter rows of jtable with textfield in netbeans
Not able to filter rows of jtable with textfield in netbeans  ...", "Item", "Qty In Boxes"}; tblStock = new JTable(data,header); sorter=new... of implementing row filter to the 4th column of jtable with a textfield but its
Java convert jtable data to pdf file
Java convert jtable data to pdf file In this tutorial, you will learn how to convert jtable data to pdf file. Here is an example where we have created... have fetched the data from the jtable and save the data to pdf file. Example
Designing of textfield arrays in Netbeans IDE - Swing AWT
in NetBeans IDE.... How can i do this.........???? I have a code which... in NetBeans IDE form designing.... public javax.swing.JTextField...Designing of textfield arrays in Netbeans IDE  Respected sir
ModuleNotFoundError: No module named 'fasta'
ModuleNotFoundError: No module named 'fasta'  Hi, My Python program is throwing following error: ModuleNotFoundError: No module named 'fasta' How to remove the ModuleNotFoundError: No module named 'fasta'
jsp using netbeans
jsp using netbeans  Code to access and manage multiple e-mail accounts on the same page.. user should be able to edit mail accounts' link as required
Draw bufferimage in jpanel using netbeans
Draw bufferimage in jpanel using netbeans  please i need urgent help. i have form which contains some fields generated in netbeans. how can i draw bufferimage in Jpanel that is inside the form. thanks
How to pretty print a JSON file in Python?
How to pretty print a JSON file in Python? In this tutorial I will teach you to read the JSON file in Python and then pretty print the content... file in Python, then use the Python function to format the JSON and print