how to read text file in jtable in netbeans7.0

how to read text file in jtable in netbeans7.0

text file is:

contig00001 length=586 numreads=4 CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt

contig00002 length=554 numreads=4 TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg ctgaggactcctcg

i want to displaythe above .txt file in jtable as following format having 3 columns

contigID length size

and then display sequence like "ATGCGSA..." in text area which is design below table in netbeans IDE. how to do that ? pls help me thankx

View Answers









Related Tutorials/Questions & Answers:
how to read text file in jtable in netbeans7.0
how to read text file in jtable in netbeans7.0  text file... want to displaythe above .txt file in jtable as following format having 3 columns contigID length size and then display sequence like "ATGCGSA..." in text
how to sort the text file and display it in jtable
how to sort the text file and display it in jtable   my text file is: contig00001 length=586 numreads=4... in jtable and sequence like "CGGGAATTAA..." in jtextarea in netbeans . pls suggest
Advertisements
How to read text file in Servlets
How to read text file in Servlets       This section illustrates you how to read text file in servlets. In this example we will use the input stream to read the text
how to read a text file with scanner in java
how to read a text file with scanner in java  Hi, I am looking for the example code in Java for reading text file line by line using the Scanner class. how to read a text file with scanner in java? Thanks   Hi
Read text File
Read text File  Hi,How can I get line and keep in a String in Java
Extract File data into JTable
Extract File data into JTable In this section, you will learn how to read the data from the text file and insert it into JTable. For this, we have created... the BufferedReader class, we have read the data of the file. This data is then broken
How to read text file to two different name array
How to read text file to two different name array   I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read text file to two different name array
How to read text file to two different name array   I have those numbers:12,4,9,5 numbers:19,12,1,1 how to put it in two different name array in text file to java
How to read the data in text file seperated by by ',' in java using IO Operations
How to read the data in text file seperated by by ',' in java using IO Operations  in Text file data like raju 45,56,67 ramu 46,65,78 raji 34,23,56 this is the student marks in text file.this data read and calculate
How to read a large text file line by line in java?
How to read a large text file line by line in java?  I have been assigned a work to read big text file and extract the data and save into database... you kind advice and let's know how to read a large text file line by line in java
how to read text file with java 8 stream api
how to read text file with java 8 stream api  Hi, I want to use Java 8 Stream API for reading text file line by line. I am trying to find example code. how to read text file with java 8 stream api? Thanks   Hi
Remove JTable row that read txt file records
Remove JTable row that read txt file records  Hi every one. i have a jtable that correctly read data frome file and show them in own. I want to add... JTable table=new JTable(); table.setModel(rR1); JPanel panel=new
Steps to read text file in pyspark
Steps to read text file in pyspark  Hi, I am learning to write program in PySpark. I want to simply read a text file in Pyspark and then try some code. What are the Steps to read text file in pyspark? How much time it takes
Read Lines from text file
read from the text file and displays the output as desired. Unable to read the rest...Read Lines from text file  Here's a brief desc of what my Java code does .. I'm using BufferedReader to read lines from a text files and split each
How to read and compare content of two different text file
Description: In the given example you will see how a two text file's content are compared. The BufferedReader class allow us to read a file. The readLine() method used to read the contents of the specified file.  The way
Java insert file data to JTable
Java insert file data to JTable In this section, you will learn how to insert text file data into JTable. Swing has provide useful and sophisticated set... with AbstractTableModel to inherit its methods and properties. Now we have read the file
Read Text file from Javascript - JSP-Servlet
Read Text file from Javascript  plz send the code How to Retrieve the data from .txt file thru Javascript? And how to find the perticular words in that file
Read text file in PySpark
Read text file in PySpark - How to read a text file in PySpark? The PySpark.../spark-2.3.0-bin-hadoop2.7/bin$ In this tutorial we have learned how to read a text file...().setAppName("read text file in pyspark") sc = SparkContext(conf=conf
read text file and store the data in mysql - JDBC
read text file and store the data in mysql  when we store the data in mysql table from text file its store the data from new line to new column. how to store the data in different column from a single line of text file
how to write and read text for javaME
how to write and read text for javaME  Hi. I have tried ur read/write coding but why i didnt get the o/p just like urs. do i have to add anything from the library? i want to type multiple line on text file then, read it from
Java read text file
In the section we are discussing about how to read file line by line. Here we... a text file one line at a time. It can also be used to read large text files... text file in Java?": ADS_TO_REPLACE_3 Example of Read text File Line
Program to read the text from a file and display it on a JFrame.
Program to read the text from a file and display it on a JFrame.  import javax.swing.*; import java.io.*; import java.lang.*; import java.awt.*; class MegaViewer1 extends JFrame { JTabbedPane jtp1=new JTabbedPane
How to read file in java
How to read file in java Java provides IO package to perform reading and writing operations with a file. In this section you will learn how to read a text... the given file name. read()-The read() method of FileInputStream class reads
How to read and retrieve jtable row values into jtextfield on clicking at particular row ...
How to read and retrieve jtable row values into jtextfield on clicking... application in which i have to display database records in jtable .now I want to read all the values of particular row at which mouse is clicked. and display
Java program to read a text file and write to another file
Java program to read a text file and write to another file - Creating.... Our requirement is to read a text file and then write the content of the text...: In this tutorial we have learned to read a text file and then write it to another file
how to read this xml file - XML
how to read this xml file  i want to read this xml file using java... read i have tried lot more , but i am not able to read this xml file... name=client menu=client action=read user employee add
how to update the text file?
how to update the text file?  if my text file contains a string and integer in each line say,: aaa 200 bbb 500 ccc 400 i need a java code to update the integer value if my input String matches with the string in file. please
Read specific column data from text file in java
Read specific column data from text file in java  My question is if my text file contain 15 columns and i want read specific column data from that text file then what code i should do
how to update the text file?
how to update the text file?  my textfile with name list.txt: Rice... i want to update the quantity in my text file, if the item i entered matches...=new float[n1]; for(int i=0;i File file ; FileReader fr=null
Read text file to 2D array and sorting the second column
Read text file to 2D array and sorting the second column  we found that the student names with marks in a text file the marks decreases significantly... their names in a text file
How to read text from - Java Beginners
How to read text from   How to retrieve text from the images... Does we have any function to get text over the images  Hi Friend, We are providing you a code that will set text over an image using javascript
How to Read a File in Java
How to Read a File in Java? In this section we are going to know, How to read a file in Java. We have to follow three step to read a File. First get... to read the Content of file . Read A File: Reading a file is nothing
Java Read Lines from Text File and Output in Reverse order to a Different Text File
Java Read Lines from Text File and Output in Reverse order to a Different Text File  I need to read a file that was selected by the user using... to another text file. When that is done the output values of that file need
how to convert image file to text file?
how to convert image file to text file?  hi, can anybody tell how to convert image file to text file? plz help me
Read Specific Line from file Using Java
Read Specific Line from file Using Java Here we are going to read a specific line from the text file. For this we have created a for loop to read lines 1 to 10 from the text file. If the loop reached fifth line, the br.readLine() method
write a program in java to read a text file and write the output to an excel file using filereader and filewriter?
write a program in java to read a text file and write the output to an excel file using filereader and filewriter?  write a program in java to read a text file and write the output to an excel file using filereader and filewriter
How To Read File In Java with BufferedReader
How To Read File In Java with BufferedReader class - example code This tutorial shows you how you can read file using BufferedReader class in your program... class: import java.io.*; /** * How To Read File In Java with BufferedReader
how to print fasta file into jtable using netbeans IDE
how to print fasta file into jtable using netbeans IDE   mt file... "and"contig00002 length=554 numreads=4" in jtable having three columns. and sequence "CGGGAAATTATCc..." in jtextarea. i made both jtable and jtextarea
How to read the .doc/ .docx file in Java Program
How to read the .doc/ .docx file in Java Program  Hi, I am beginner in Java programming language. Can anybody explain How to read .doc file in Java... to read the word document file. For doing this we will make class HWPFDocument which
how to read file using InputStreamReader in java
how to read file using InputStreamReader in java  Hi, I want to learn to use the InputStreamReader class of Java and trying to read a text file with the class. how to read file using InputStreamReader in java? Thanks  
How To Read File In Java
How To Read File In Java In this section we will discuss about about how data of a file can be read in Java. A file can contain data as bytes, characters..._TO_REPLACE_1 Example This example demonstrates that how to read a file in java
How to Read a file line by line using BufferedReader?
How to Read a file line by line using BufferedReader?  Hello Java... to me in my company. Here I have many big text files. I have to read these files... problem is to find the best way to read the file in Java. I just searched the google
How to read properties file in Java?
a property file in Java: "How to read properties file in Java?" ADS... to value. The java.util.Properties class is used to read the properties file. The properties files are simple text file which is saved as .properties
How to make a file read-only
Description: This example demonstrate how to create a file and how to revoke... a file with specified name with read-only attribute. You can also check the the file properties, by default it is read-only. ADS_TO_REPLACE_1
How to read properties file in java
How to read properties file in java Description of Example:- In this example... is the video tutorial of: "How to read properties file in Java?" How we... read properties file;-ADS_TO_REPLACE_1 ResourceBundle. Properties Class
how to read and write an xml file using java
how to read and write an xml file using java  Hi Can anyone help me how to read and write an xml file which has CData using java
How to read an eml file? - Java Beginners
How to read an eml file?  Hello dears, now i want to read en eml file stored in a folder. is it possible to use the same code for reading a txt file? or do i have to use javamail api? Thanks Spalax
how to read the .proprties file from struts - Struts
how to read the .proprties file from struts   errpr is :file not found exception:applicationresource.proprties file {system canot find file path"; How to set the file path.  Hi Friend, It seems that you haven't
How to read excel2007 file - JSP-Servlet
How to read excel2007 file  Dear sir , I am able to read a excel 97-2003(.xls)files using apache poi.But for 2007(.xlsx)files to read... Friend, For reading .xls file you used HSSFWorkbook. but for .xlsx file reading
How to read a line from a doc file
How to read a line from a doc file  How to read a line from a doc file   Hi Friend, To run the following code, you need to download POI... { public static void main(String[] args) { File file = null; WordExtractor

Ads